Media Library
Annotated Zebrafish Anatomical Ontology (ZFA) Expression Tags:
lateral line system, neuromast, peripheral nervous system
Maternal mRFP:
Known Phenotypes:
Viability:
Line Designation: GBT1168
Lab: Ekker lab - Mayo Clinic
GBT Plasmid:
RP2
Tagged Gene: intergeneic
Tagged Gene Status: Confirmed
Alternative Gene Names: Intergenic
Alternative Names: Intergenic
Allele: mn1168Gt
Insertion Location:
5' Genome:
3' Genome:
RACE Tags: 5' RACE:
3' RACE:
Links: ZFIN Ensembl Entrez Gene
Additional Molecular Data
RFP Linkage Analysis:
Gene Primer: GBT 1168 F2 [cagacagcaggttcttggcac]
Trap Primer: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genotyping Primers:
Gene-P1: GBT 1168 F2 [cagacagcaggttcttggcac]
Gene-P2: GBT 1168 R2 [gcctcacagcaagaacgtgg]
Trap-P3: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genome Location: chr5:39664405-39664412 (ZV10)
Quantitative PCR Measurements: Knockdown Figure not provided
F primer:
R primer:
Trap primer:
Reference Gene:
MO Information
MO:
MO suggested dose:
MO phenotype(s):
No assay history for Henley lab
No assay history for Hyperosmotic Stress
No assay history for Morphological Phenotype
No assay history for Nicotine Biology
No assay history for tcap induction assay
Expression Summary:
Digital Notebook Entries:
|
No News to Display
There are no news stories to display. There may be no news for this topic or your user preferences may be too restrictive for topic GBT1168
