Media Library
Annotated Zebrafish Anatomical Ontology (ZFA) Expression Tags:
digestive system, gut
Maternal mRFP:
Known Phenotypes:
Viability:
Line Designation: GBT0980
Lab: Ekker lab - Mayo Clinic
GBT Plasmid:
RP2.1
Tagged Gene: hmcn1; hemicentin 1
(from GenBank)
Tagged Gene Status: Confirmed
Alternative Gene Names: si:ch211-169j21.3
(from GenBank)
Alternative Names:
Allele: mn0980Gt
Insertion Location:
5' Genome:
3' Genome:
RACE Tags: 5' RACE:
3' RACE:
Links:  ZFIN Ensembl Entrez Gene
Additional Molecular Data
RFP Linkage Analysis:
Gene Primer: GBT 980 F1 [gatgtacctcagagacgagcaaagc]
Trap Primer: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genotyping Primers:
Gene-P1: GBT 980 F1 [gatgtacctcagagacgagcaaagc]
Gene-P2: GBT 980 R2 [gggaaatgaagtttcagctacctcc]
Trap-P3: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genome Location: 20:34381545-34381553 (ZV10)
Quantitative PCR Measurements: Knockdown Figure not provided
F primer:
R primer:
Trap primer:
Reference Gene:
MO Information
MO:
MO suggested dose:
MO phenotype(s):
No assay history for Henley lab
No assay history for Hyperosmotic Stress
No assay history for Morphological Phenotype
No assay history for Nicotine Biology
No assay history for tcap induction assay
Expression Summary:
Digital Notebook Entries:
|
No News to Display
There are no news stories to display. There may be no news for this topic or your user preferences may be too restrictive for topic GBT0980