Media Library
Annotated Zebrafish Anatomical Ontology (ZFA) Expression Tags:
brain, central nervous system, coelom, immune system, kidney, olfactory pit, olfactory system, peripheral olfactory organ, renal system, trunk
Maternal mRFP:
Known Phenotypes:
Viability:
Line Designation: GBT0951
Lab: Ekker lab - Mayo Clinic
GBT Plasmid:
RP2.1
Tagged Gene: macrod2; mono-ADP ribosylhydrolase 2
(from GenBank)
Tagged Gene Status: Confirmed
Alternative Gene Names: zgc:65960
(from GenBank)
Alternative Names:
Allele: mn0951Gt
Insertion Location:
5' Genome:
3' Genome:
RACE Tags: 5' RACE:
3' RACE:
Links: ZFIN Ensembl Entrez Gene
Additional Molecular Data
RFP Linkage Analysis:
Gene Primer: GBT 951 F1 [caacaatgcgccttaacacacctcc]
Trap Primer: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genotyping Primers:
Gene-P1: GBT 951 F1 [caacaatgcgccttaacacacctcc]
Gene-P2: GBT 951 R1 [tgctattttcagaccagcgcaaccc]
Trap-P3: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genome Location: 13:34378247-34378255 (ZV10)
Quantitative PCR Measurements: Knockdown Figure not provided
F primer:
R primer:
Trap primer:
Reference Gene:
MO Information
MO:
MO suggested dose:
MO phenotype(s):
No assay history for Henley lab
No assay history for Hyperosmotic Stress
No assay history for Morphological Phenotype
No assay history for Nicotine Biology
No assay history for tcap induction assay
Expression Summary:
Digital Notebook Entries:
|
No News to Display
There are no news stories to display. There may be no news for this topic or your user preferences may be too restrictive for topic GBT0951
