Media Library
Annotated Zebrafish Anatomical Ontology (ZFA) Expression Tags:
Maternal mRFP:
Known Phenotypes:
Viability:
Line Designation: GBT0536
Lab: Ekker lab - Mayo Clinic
GBT Plasmid:
RP2.1
Tagged Gene: si:ch211-266g18.10
(from GenBank)
Tagged Gene Status: Candidate
Alternative Gene Names:
Alternative Names:
Allele: mn0536Gt
Insertion Location:
5' Genome:
3' Genome:
RACE Tags: 5' RACE:
3' RACE:
Links:  ZFIN Ensembl Entrez Gene
Additional Molecular Data
RFP Linkage Analysis:
Gene Primer:
Trap Primer:
Genotyping Primers:
Gene-P1: GNT_GBT0536_&_510_f1_ CU306817.2 [TGTTGAGCAGGAAGGTTCAGATGG]
Gene-P2: GNT_GBT0536_&_510_r1_ CU306817.2 [ACATTGCCCAACCCTAGTCTC]
Trap-P3:
Genome Location: 17:15325871-15325879 (ZV9)
Quantitative PCR Measurements: Knockdown Figure not provided
F primer:
R primer:
Trap primer:
Reference Gene:
MO Information
MO:
MO suggested dose:
MO phenotype(s):
No assay history for Henley lab
No assay history for Hyperosmotic Stress
No assay history for Morphological Phenotype
No assay history for Nicotine Biology
No assay history for tcap induction assay
Expression Summary:
Digital Notebook Entries:
|
No News to Display
There are no news stories to display. There may be no news for this topic or your user preferences may be too restrictive for topic GBT0536