Media Library
Annotated Zebrafish Anatomical Ontology (ZFA) Expression Tags:
cardiovascular system, coelom, heart, trunk
Maternal mRFP:
Known Phenotypes: No observed to date
Viability: Adult homozygous survival
Line Designation: GBT0423
Lab: Xu lab - Mayo Clinic
GBT Plasmid:
RP2.1
Tagged Gene: ENSDARG00000091251
Tagged Gene Status: Candidate
Alternative Gene Names:
Alternative Names: RP2_#277
Allele: xu0423GT
Insertion Location:
5' Genome:
GBT0423_5.txt 3' Genome:
GBT0423_3.txtRACE Tags: 5' RACE:
GBT0423_5R.txt 3' RACE:
Links:  ZFIN Ensembl Entrez Gene
Additional Molecular Data
RFP Linkage Analysis:
Gene Primer:
Trap Primer:
Genotyping Primers:
Gene-P1: CAGTCAAAGGAACTCTCGTTTCCCC
Gene-P2: ACCAAAAGTGCCTCAAAAGCTAGAC
Trap-P3: GTACAGTAATCAAGTAAAATTACTCA
Genome Location:
Quantitative PCR Measurements: Knockdown Figure not provided
F primer:
R primer:
Trap primer:
Reference Gene:
MO Information
MO:
MO suggested dose:
MO phenotype(s):
No assay history for Henley lab
No assay history for Hyperosmotic Stress
No assay history for Morphological Phenotype
No assay history for Nicotine Biology
No assay history for tcap induction assay
Digital Notebook Entries:
|
No News to Display
There are no news stories to display. There may be no news for this topic or your user preferences may be too restrictive for topic GBT0423