Media Library
Annotated Zebrafish Anatomical Ontology (ZFA) Expression Tags:
Maternal mRFP: Y
Known Phenotypes:
Viability:
Line Designation: GBT0396
Lab: Ekker lab - Mayo Clinic
GBT Plasmid:
RP2.1
Tagged Gene: smg9; SMG9 nonsense mediated mRNA decay factor
(from GenBank)
Tagged Gene Status: Confirmed
Alternative Gene Names: fj67f05, si:dkey-79d12.3, wu:fj67f05
(from GenBank)
Alternative Names: RP2 709
Allele: mn0396GT
Insertion Location:
5' Genome:
3' Genome:
RACE Tags: 5' RACE:
3' RACE:
Links: ZFIN Ensembl Entrez Gene
Additional Molecular Data
RFP Linkage Analysis:
Gene Primer:
Trap Primer: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genotyping Primers:
Gene-P1: GNT_GBT0396_f1_ wu:fj67f05 [CCCTGTTTGTGTGGGTTTCCTC]
Gene-P2: GNT_GBT0396_r1_ wu:fj67f05 [ACACTAAAGATGGCTGTCCACG]
Trap-P3:
Genome Location: 16:26963184-26963192 (ZV9)
Quantitative PCR Measurements: Knockdown Figure not provided
F primer:
R primer:
Trap primer:
Reference Gene:
MO Information
MO:
MO suggested dose:
MO phenotype(s):
No assay history for Henley lab
No assay history for Hyperosmotic Stress
No assay history for Morphological Phenotype
No assay history for Nicotine Biology
No assay history for tcap induction assay
Expression Summary:
Digital Notebook Entries:
|
No News to Display
There are no news stories to display. There may be no news for this topic or your user preferences may be too restrictive for topic GBT0396
