Media Library
Annotated Zebrafish Anatomical Ontology (ZFA) Expression Tags:
coelom, immune system, kidney, renal system, trunk
Maternal mRFP: Y
Known Phenotypes:
Viability:
Line Designation: GBT0251
Lab: Ekker lab - Mayo Clinic
GBT Plasmid:
RP2.1
Tagged Gene: foxl2a; forkhead box L2a
(from GenBank)
Tagged Gene Status: Confirmed
Alternative Gene Names: foxl2, foxl2-1, foxl2-2, zgc:136549
(from GenBank)
Alternative Names: RP2 651, SEC0251
Allele: mn0251GT
Insertion Location:
5' Genome:
3' Genome:
RACE Tags: 5' RACE:
3' RACE:
Links:  ZFIN Ensembl Entrez Gene
Additional Molecular Data
RFP Linkage Analysis:
Gene Primer:
Trap Primer: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genotyping Primers:
Gene-P1: gnt_gbt0251_f1_foxl2 [CAACAGACTTCTGCACCTGCTTTAC]
Gene-P2: gnt_gbt0251_r1_foxl2 [CATCAATGCCCGTGCTTCC]
Trap-P3:
Genome Location: 15:6984981-6984989 (ZV9)
Quantitative PCR Measurements: Knockdown Figure not provided
F primer:
R primer:
Trap primer:
Reference Gene: http://www.ncbi.nlm.nih.gov/gene/406349
MO Information
MO:
MO suggested dose:
MO phenotype(s): Describe any observed MO phenotype
No assay history for Henley lab
No assay history for Hyperosmotic Stress
No assay history for Morphological Phenotype
No assay history for Nicotine Biology
No assay history for tcap induction assay
Expression Summary:
Digital Notebook Entries:
|
No News to Display
There are no news stories to display. There may be no news for this topic or your user preferences may be too restrictive for topic GBT0251