Media Library
Annotated Zebrafish Anatomical Ontology (ZFA) Expression Tags:
digestive system, gut
Maternal mRFP:
Known Phenotypes:
Viability:
Line Designation: GBT0187
Lab: Ekker lab - Mayo Clinic
GBT Plasmid:
RP2.1
Tagged Gene: si:dkey-253d23.3
(from GenBank)
Tagged Gene Status: Confirmed
Alternative Gene Names:
Alternative Names: SEC0057, SEC0187
Allele: mn0187GT
Insertion Location:
5' Genome:
GBT0187_5.txt 3' Genome:
GBT0187_3.txtRACE Tags: 5' RACE:
3' RACE:
Links: ZFIN Ensembl Entrez Gene
Additional Molecular Data
RFP Linkage Analysis:
Gene Primer:
Trap Primer: 5R-mRFP-P2 [ccttgaagcgcatgaactccttgat]
Genotyping Primers:
Gene-P1: gnt_gbt0187_f1 [TTCCAGCCGCAACCCATCTC]
Gene-P2: gnt_gbt0187 [GTATTCAGATGTGTGATGCGGTTTG]
Trap-P3:
Genome Location: 22:9974492-9974500 (ZV9)
Quantitative PCR Measurements: Knockdown Figure not provided
F primer:
R primer:
Trap primer:
Reference Gene: http://www.ncbi.nlm.nih.gov/gene/406349
MO Information
MO:
MO suggested dose:
MO phenotype(s): Describe any observed MO phenotype
No assay history for Henley lab
No assay history for Hyperosmotic Stress
No assay history for Morphological Phenotype
No assay history for Nicotine Biology
No assay history for tcap induction assay
Expression Summary:
Digital Notebook Entries:
|
No News to Display
There are no news stories to display. There may be no news for this topic or your user preferences may be too restrictive for topic GBT0187
